si:ch211-271f14.1

Ensembl ID:
ENSDARG00000076560
ZFIN ID:
ZDB-GENE-091118-127
Human Orthologue:
APBB1
Human Description:
amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) [Source:HGNC Symbol;Acc:581]
Mouse Orthologue:
Apbb1
Mouse Description:
amyloid beta (A4) precursor protein-binding, family B, member 1 Gene [Source:MGI Symbol;Acc:MGI:1077

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9076 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21692 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115130 Essential Splice Site 656 710 12 13
ENSDART00000136709 Essential Splice Site 637 681 12 13

The following transcripts of ENSDARG00000076560 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16021609)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16034916
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATCCAAATGCAGCCAGTCTAAGTGAGGCCGTACAGGCTGCCTGCATG[G/A]TGAGCAAGGAATACCTAGTACATTCTTTACATACTTGCCCATTACTATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115130 Essential Splice Site 656 710 None 13
ENSDART00000136709 Essential Splice Site 637 681 None 13

The following transcripts of ENSDARG00000076560 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 16021610)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 16034917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCCAAATGCAGCCAGTCTAAGTGAGGCCGTACAGGCTGCCTGCATGG[T/C]GAGCAAGGAATACCTAGTACATTCTTTACATACTTGCCCATTACTATACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link