RB1CC1

Ensembl ID:
ENSDARG00000076559
Description:
RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
Human Orthologue:
RB1CC1
Human Description:
RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
Mouse Orthologue:
Rb1cc1
Mouse Description:
RB1-inducible coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1341850]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5083 Nonsense Mutation detected in F1 DNA During 2014
sa24535 Nonsense Available for shipment Available now
sa4263 Nonsense Mutation detected in F1 DNA During 2014
sa24536 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 65 1625 2 22
Genomic Location:
Chromosome 24 (position 36466857)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGGGGAATGTATGGTGGCAGAGAGGCGGGTGTGCAGCTACAGCGCT[G/T]GAACAGTGAGTAACAAGCAAAATCACACCACAACAGTGCTTATTTAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 866 1625 13 22
Genomic Location:
Chromosome 24 (position 36480712)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCAGTAATGTCAGTTACTCTCATGAAGAGGAGCTAAAAGAAACACAA[C/T]AAACCCATCTCCAGAGTTTAAAAGAGGACCATGAAAAGCAGATACGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 1001 1625 13 22
Genomic Location:
Chromosome 24 (position 36481117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGCTGAGAAGGTGCATCTTCAGGAACTGGAGACACGGTTGAACCAG[C/T]AACAYGAAGCAGAACTGCAGACTTTCAGACTAGAAAAAGAAAGTGCGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Splice Site, Nonsense 1576 1625 21 22
Genomic Location:
Chromosome 24 (position 36497657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATATTACTCACTCTTTCTTTTTTTCCCCCTTTTTCTTTTTTCTTTTTC[T/A]AGCGACAGGAGCAACAAGACGGCCGTGGGTTCTGGGAAAAGTCATGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yxjsdypz