RB1CC1

Ensembl ID:
ENSDARG00000076559
Description:
RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
Human Orthologue:
RB1CC1
Human Description:
RB1-inducible coiled-coil 1 [Source:HGNC Symbol;Acc:15574]
Mouse Orthologue:
Rb1cc1
Mouse Description:
RB1-inducible coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1341850]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37934 Nonsense Available for shipment Available now
sa44173 Nonsense Mutation detected in F1 DNA During 2016
sa24535 Nonsense Available for shipment Available now
sa24536 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37934
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 512 1625 8 22
Genomic Location (Zv9):
Chromosome 24 (position 36477392)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35096307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTGCTGTAGTGGAGGTGGTCCGGCGCAAAATGTTCATAGGACACTA[C/A]AGACAAGTAAGAATCTGCTGCTTTACTTTGTGTGATTATAGGGAATGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 831 1625 13 22
Genomic Location (Zv9):
Chromosome 24 (position 36480607)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35099522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAAAAGTTAAAGAAGACCTTTATCATTTTCGAGGTCTTGTTCTGAAA[G/T]AGCAACGGGACTTTGGATTCGCCCTGAAAACAATGACCACTGAGGTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Nonsense 866 1625 13 22
Genomic Location (Zv9):
Chromosome 24 (position 36480712)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35099627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCAGTAATGTCAGTTACTCTCATGAAGAGGAGCTAAAAGAAACACAA[C/T]AAACCCATCTCCAGAGTTTAAAAGAGGACCATGAAAAGCAGATACGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113014 Splice Site, Nonsense 1576 1625 21 22
Genomic Location (Zv9):
Chromosome 24 (position 36497657)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35116572
KASP Assay ID:
2261-8953.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATATTACTCACTCTTTCTTTTTTTCCCCCTTTTTCTTTTTTCTTTTTC[T/A]AGCGACAGGAGCAACAAGACGGCCGTGGGTTCTGGGAAAAGTCATGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link