trim32

Ensembl ID:
ENSDARG00000076553
ZFIN ID:
ZDB-GENE-060428-1
Description:
E3 ubiquitin-protein ligase TRIM32 [Source:RefSeq peptide;Acc:NP_001107066]
Human Orthologue:
TRIM32
Human Description:
tripartite motif-containing 32 [Source:HGNC Symbol;Acc:16380]
Mouse Orthologue:
Trim32
Mouse Description:
tripartite motif-containing 32 Gene [Source:MGI Symbol;Acc:MGI:1917057]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa92 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa92
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111216 Nonsense 31 663 1 1
Genomic Location:
Chromosome Zv9_NA154 (position 31940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGCTGGAATGCCCCATCTGCCTAGAGACCTACAACCAGGATCAGCTT[C/T]GACCCAAACTTCTGCAGTGTGGTCACTCAGTGTGTCGCCAGTGCCTTGAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gd39sjhh