setd8b

Ensembl ID:
ENSDARG00000076551
ZFIN IDs:
ZDB-GENE-071004-17, ZDB-GENE-071004-17
Description:
histone-lysine N-methyltransferase SETD8 [Source:RefSeq peptide;Acc:NP_001093559]
Human Orthologues:
AL356585.2, SETD8
Human Description:
SET domain containing (lysine methyltransferase) 8 [Source:HGNC Symbol;Acc:29489]
Mouse Orthologue:
Setd8
Mouse Description:
SET domain containing (lysine methyltransferase) 8 Gene [Source:MGI Symbol;Acc:MGI:1915206]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20592 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098758 Essential Splice Site 182 315 6 8
ENSDART00000123165 Essential Splice Site 182 315 6 8
Genomic Location (Zv9):
Chromosome 5 (position 72819452)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 69017048
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGCACATTGAGGATCTCATCAAAAACGATGTGGAAGAGGGACTGAAG[G/A]TGAGCTTTTTAACATTAGCTTATGTTTATCTTCTACCTGACATCCTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link