ENSDARG00000076547

Ensembl ID:
ENSDARG00000076547
Mouse Orthologue:
Abcc5
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 5 Gene [Source:MGI Symbol;Acc:MGI:1351644]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2779 Nonsense Mutation detected in F1 DNA During 2014
sa16679 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112930 Nonsense 112 846 3 16
Genomic Location:
Chromosome 14 (position 24532988)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCATGTTCCAAATAAAATCACTCGCTGTGTTTTGCAGACTGGAGTG[G/A]CTGTGGCACGAGGAACTGAAGCGACGGGGGAAGGATGGGGCRTCTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112930 Nonsense 133 846 3 16
Genomic Location:
Chromosome 14 (position 24533050)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACTGAAGCGACGGGGGAAGGATGGGGCRTCTCTGTCTCGGGTGTTCT[G/A]GAGGTTTTGTCAGACTCGCATGCTGGTGGCCATCTTCTCCCTGCTCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0jvcflet