aldh5a1

Ensembl ID:
ENSDARG00000076544
ZFIN ID:
ZDB-GENE-070228-2
Description:
succinate-semialdehyde dehydrogenase, mitochondrial [Source:RefSeq peptide;Acc:NP_001103938]
Human Orthologue:
ALDH5A1
Human Description:
aldehyde dehydrogenase 5 family, member A1 [Source:HGNC Symbol;Acc:408]
Mouse Orthologue:
Aldh5a1
Mouse Description:
aldhehyde dehydrogenase family 5, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:2441982]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17724 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17724
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013188 Nonsense 487 514 10 10
ENSDART00000109087 None None 426 None 8
ENSDART00000131516 Nonsense 453 480 10 10

The following transcripts of ENSDARG00000076544 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 38348237)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACGAAGGCATGATCTCCACCACCGAAGCCCCTTTTGGAGGAATCAAA[C/T]AGTCCGGATTGGGCAGAGAAGGATCCATATATGGCGTTGATGAGTATCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/26p24vev