pogzb

Ensembl ID:
ENSDARG00000076542
ZFIN ID:
ZDB-GENE-100609-3
Human Orthologue:
POGZ
Human Description:
pogo transposable element with ZNF domain [Source:HGNC Symbol;Acc:18801]
Mouse Orthologue:
Pogz
Mouse Description:
pogo transposable element with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:2442117]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36215 Nonsense Mutation detected in F1 DNA During 2017
sa8599 Nonsense Mutation detected in F1 DNA During 2017
sa15926 Nonsense Available for shipment Available now
sa14074 Essential Splice Site Available for shipment Available now
sa12020 Nonsense Available for shipment Available now
sa16289 Splice Site, Nonsense Available for shipment Available now
sa42784 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9652 Essential Splice Site Available for shipment Available now
sa15093 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Nonsense 121 1320 4 22
ENSDART00000128542 Nonsense 124 1349 4 18
ENSDART00000132087   None 1031 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40786646)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38171446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTCATCTTGGCACCAGGAGGAGGTGGACTGGGCACTGTGGCTCTGTCA[C/T]AGGTTCTCCTGCCTGGAACATCTATTGCCAATGTTACCAACAGTCAGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Nonsense 159 1320 5 22
ENSDART00000128542 Nonsense 162 1349 5 18
ENSDART00000132087   None 1031 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40786859)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38171659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGGTCTTCCTGTCCAGAATATCCAGCCTGGCCAGGGTCCAATGAGTT[T/G]AGTGCTGAATGTYCAACAAGGCCAAACTGTTCGACCGATTACTCTACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15926
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Nonsense 292 1320 7 22
ENSDART00000128542 Nonsense 308 1349 7 18
ENSDART00000132087   None 1031 None 11
Genomic Location (Zv9):
Chromosome 16 (position 40789956)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38174756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTMTATTTACAGTGACAATAAAGCAAGGAAATGGACCCCTAGACATG[C/T]AAAACCTAATGAATCTTGTGAAGTCTGTGAACCTTCCTGGTGGGGCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Essential Splice Site 469 1320 9 22
ENSDART00000128542 Essential Splice Site 485 1349 9 18
ENSDART00000132087 Essential Splice Site 95 1031 1 11
Genomic Location (Zv9):
Chromosome 16 (position 40790644)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38175444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATCATTCAGATGCCTGACCTGTAGCAAGAAACTAAAGAATAATATTAGG[T/A]ACGATTATGGACTGATTTTAGAAGTCTTATTGTAAATATCTAGTTGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12020
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Nonsense 596 1320 12 22
ENSDART00000128542 Nonsense 612 1349 12 18
ENSDART00000132087 Nonsense 222 1031 4 11
Genomic Location (Zv9):
Chromosome 16 (position 40792949)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38177749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTTCTGTGCCAGTATTGCCTGAAGGTTTTCAAGCATTCCACCAGTTAC[C/T]AGCAACAYTATGTTCGTCATCAGGYRAGGATAGGAAGCATMAAATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Splice Site, Nonsense 603 1320 12 22
ENSDART00000128542 Splice Site, Nonsense 619 1349 12 18
ENSDART00000132087 Splice Site, Nonsense 229 1031 4 11
Genomic Location (Zv9):
Chromosome 16 (position 40792970)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38177770
KASP Assay ID:
2261-0111.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGTTTTCAAGCATTCCACCAGTTACYAGCAACAYTATGTTCGTCAT[C/T]AGGYRAGGATAGGAAGCATMAAATTTTAATTAAARAYAAAACTAAWTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Essential Splice Site 648 1320 13 22
ENSDART00000128542 Essential Splice Site 664 1349 13 18
ENSDART00000132087 Essential Splice Site 274 1031 5 11
Genomic Location (Zv9):
Chromosome 16 (position 40794687)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38179487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTTCCGAAAGCCCCGTGAATTGGATGGACTGCAGCCTGGAACAAAAG[T/A]AAAATCTTTGTTTGTTTGTTTATGTGAGACTGAGAGTAAATTTGCAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Essential Splice Site 769 1320 None 22
ENSDART00000128542 Essential Splice Site 793 1349 None 18
ENSDART00000132087 Essential Splice Site 404 1031 None 11
Genomic Location (Zv9):
Chromosome 16 (position 40795682)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38180482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATGTYCCTGGAAGGGCTCCAAAACCTTCTAAAAAGGGGCCTCCAAGG[T/C]AATGTAATATTTGKATTTTGAGTTCTGTTTTGCTCAGTCTGAAACTGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113473 Nonsense 944 1320 21 22
ENSDART00000128542 Nonsense 951 1349 18 18
ENSDART00000132087 Nonsense 579 1031 11 11
Genomic Location (Zv9):
Chromosome 16 (position 40799227)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 38184027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAAGCAGCAAAAGAGATGRACACCAAACCGCAGCTCATCAAGACCTG[G/A]ATTCAAGACAAGGAGGATCAGTTAAATGAATGCTGCAGCAGTATCTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link