LOC558772

Ensembl ID:
ENSDARG00000076533
Human Orthologue:
NFE2L1
Human Description:
nuclear factor (erythroid-derived 2)-like 1 [Source:HGNC Symbol;Acc:7781]
Mouse Orthologue:
Nfe2l1
Mouse Description:
nuclear factor, erythroid derived 2,-like 1 Gene [Source:MGI Symbol;Acc:MGI:99421]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31880 Nonsense Mutation detected in F1 DNA During 2016
sa42051 Nonsense Mutation detected in F1 DNA During 2016
sa11267 Nonsense Available for shipment Available now
sa10608 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110934 Nonsense 21 815 2 6
Genomic Location:
Chromosome 12 (position 30403890)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTTGCTTTTTGAGTTTTCTTTTTTGTTCCTTTGCAAAGAAATGCTTTA[C/A]TTGAAAAAGTACTTCACAGAGGGTCTTATTCAGTTCACTATCCTCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110934 Nonsense 317 815 5 6
Genomic Location:
Chromosome 12 (position 30408524)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCATTTTGCATTGTCTTTTATAGTTCCAGGCCACTGCTCCCACCTCA[C/T]AGCTGAGAGCTACAACTGAAGAAACGCCTTCAACGTCACAAGGGATTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110934 Nonsense 330 815 5 6
Genomic Location:
Chromosome 12 (position 30408563)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCCACCTCACAGCTGAGAGCTACAACTGAAGAAACGCCTTCAACGTCA[C/T]AAGGGATTCCTCTACAACCCACACTGTCGCAGACCGATACRCCACTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10608
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110934 Nonsense 519 815 6 6
Genomic Location:
Chromosome 12 (position 30410745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGCCAAGCCCAGGCTTCTCAGCTCGAGGATGAGCTTGATTCAGACT[C/A]AGGTCTTTCTTTGGATTCCAGCCATAGTCCAGCATCTCCCAGCAACTCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Epilepsy (generalized): Genome-wide association analysis of genetic generalized epilepsies implicates susceptibility loci at 1q43, 2p16.1, 2q22.3 and 17q21.32 (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link