nola1

Ensembl ID:
ENSDARG00000076526
ZFIN ID:
ZDB-GENE-040426-893
Description:
H/ACA ribonucleoprotein complex subunit 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVE0]
Human Orthologue:
GAR1
Human Description:
GAR1 ribonucleoprotein homolog (yeast) [Source:HGNC Symbol;Acc:14264]
Mouse Orthologue:
Gar1
Mouse Description:
GAR1 ribonucleoprotein homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1930948]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42439 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22535 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa42439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111189 Essential Splice Site 137 225 4 7
ENSDART00000122339 Essential Splice Site 137 225 4 7
Genomic Location (Zv9):
Chromosome 14 (position 45857430)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 43202442
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAACTTTCTGATAATATGAAGGCATCCTCATTCAAAAAGTTACAGAAG[G/A]TAAGTTCAGCCTTTTGAATTTTCTTTGTTCTCTGTTTTTTAAATGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22535
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111189 Essential Splice Site 222 225 6 7
ENSDART00000122339 Missense 223 225 6 7
Genomic Location (Zv9):
Chromosome 14 (position 45853486)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 43198498
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGATTCAGAGGAGGCAGAGGTGGAGGCGGTGGACGTGGATTCAGAG[G/A]TAAATTAGCAGATCGTCAGAAATAAGTCATCTAAATGAAAATGTCTTTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link