NP_001017580.1

Ensembl ID:
ENSDARG00000076525
Description:
NAD kinase [Source:RefSeq peptide;Acc:NP_001017580]
Human Orthologue:
NADK
Human Description:
NAD kinase [Source:HGNC Symbol;Acc:29831]
Mouse Orthologue:
Nadk
Mouse Description:
NAD kinase Gene [Source:MGI Symbol;Acc:MGI:2183149]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25445 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32567 Nonsense Available for shipment Available now
sa30442 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111254 Essential Splice Site 46 317 1 8
Genomic Location (Zv9):
Chromosome Zv9_NA913 (position 1652)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150253.1 1652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAGAGCTTTGTCTCTGTCAAGAAGAACATTTGCACTTTTAGAGAAGG[T/C]GAGACTTCATTTTCAATCAATCATTCATTCATTCCTTCATTTTTCTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111254 Nonsense 154 317 4 8
Genomic Location (Zv9):
Chromosome Zv9_NA913 (position 6486)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53186479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAGCTTACTAATGGAGACGCTGAACCCAACCACAAAACTATGCAGTA[T/A]CAAGTGAGTACCAGAGCCTGTATTATTCACTTTCAGAGAGCCTCTAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111254 Nonsense 193 317 6 8
Genomic Location (Zv9):
Chromosome Zv9_NA913 (position 8752)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53188745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAGCGTGATGTGTTGCGTGTTGTTCTCTCTGTCAGGAGTGTTGGTGT[C/A]GACTCCCACTGGAAGCACAGCTTATGCAGTGGCAGCCGGAGCCTCCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link