LOC569768

Ensembl ID:
ENSDARG00000076508
Human Orthologue:
GRM8
Human Description:
glutamate receptor, metabotropic 8 [Source:HGNC Symbol;Acc:4600]
Mouse Orthologue:
Grm8
Mouse Description:
glutamate receptor, metabotropic 8 Gene [Source:MGI Symbol;Acc:MGI:1351345]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24692 Nonsense Available for shipment Available now
sa24693 Nonsense Available for shipment Available now
sa14553 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112940 Nonsense 23 907 1 10
Genomic Location (Zv9):
Chromosome 25 (position 27789966)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26480060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGTATGGCTGTCTTCTTCTTCTAACTGGGGTGACTAGATCCATCAGC[C/T]AGCGTACGGATCCACTGACTCCCCCTGCTCCTGAATATGCCCATTCTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112940 Nonsense 97 907 1 10
Genomic Location (Zv9):
Chromosome 25 (position 27790189)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26480283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTATCGACCTCATCAATAAAGACCCTGACCTGCTGCCCAATGTTACCT[T/A]GGGGGCGCGCATTTTGGACACCTGTTCACGAGACACTTATGCCCTGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112940 Nonsense 216 907 2 10
Genomic Location (Zv9):
Chromosome 25 (position 27877007)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26567101
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCAGGCCCAAGCCATGCTGGACATCGTGACCGCCATGGGGTGGAACTA[T/A]GTTTCCACACTGGCATCTGAAGGGAATTACGGAGAGAGCGGTGTTGAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link