LOC100150267

Ensembl ID:
ENSDARG00000076501
Human Orthologue:
ASXL2
Human Description:
additional sex combs like 2 (Drosophila) [Source:HGNC Symbol;Acc:23805]
Mouse Orthologue:
Asxl2
Mouse Description:
additional sex combs like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1922552]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11731 Nonsense Available for shipment Available now
sa32165 Nonsense Mutation detected in F1 DNA During 2016
sa36473 Nonsense Mutation detected in F1 DNA During 2016
sa18273 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108514 Nonsense 435 1211 11 12
Genomic Location (Zv9):
Chromosome 17 (position 37333301)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37218198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCGGTKATAGAGGTCATTCACATGGAGCTGAGATCCAGAGATGTGAAAT[C/A]AACTGTARTGCATACCTCTYCTGAAGAGCCTGTCAAACTTYCTGCCTCWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108514 Nonsense 527 1211 11 12
Genomic Location (Zv9):
Chromosome 17 (position 37333026)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37217923
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGAGACACATAGCACAAAAGAGGAAAGTCCTGTTAGTGGGGCTGGA[C/T]AGGCATTAACGGAAAGGAATAAGGGTGGATCTACAGCAACTGCTGTCACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36473
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108514 Nonsense 741 1211 12 12
Genomic Location (Zv9):
Chromosome 17 (position 37331998)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37216895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGTGCGAGCCAGGGTTTTTTAAAAGAAAATCGCTCTTCGTTTGGGT[T/A]GCAAACCACTCAGTGCTCATTGAACCCAATAGGCAAGGATCAGCATTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108514 Nonsense 1081 1211 12 12
Genomic Location (Zv9):
Chromosome 17 (position 37330978)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 37215875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTTGATATGTGCAGCACTATACAGGGTAAAACAGAGCCATATCAAT[T/A]AAGTGACTGTCACCAACGCAYGTTCTTGCCTCAGAAAGCCCATAATGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link