LOC100150267

Ensembl ID:
ENSDARG00000076501
Human Orthologue:
ASXL2
Human Description:
additional sex combs like 2 (Drosophila) [Source:HGNC Symbol;Acc:23805]
Mouse Orthologue:
Asxl2
Mouse Description:
additional sex combs like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1922552]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11731 Nonsense Available for shipment Available now
sa18273 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108514 Nonsense 435 1211 11 12
Genomic Location:
Chromosome 17 (position 37333301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCCGGTKATAGAGGTCATTCACATGGAGCTGAGATCCAGAGATGTGAAAT[C/A]AACTGTARTGCATACCTCTYCTGAAGAGCCTGTCAAACTTYCTGCCTCWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108514 Nonsense 1081 1211 12 12
Genomic Location:
Chromosome 17 (position 37330978)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGCTTGATATGTGCAGCACTATACAGGGTAAAACAGAGCCATATCAAT[T/A]AAGTGACTGTCACCAACGCAYGTTCTTGCCTCAGAAAGCCCATAATGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7eprlwyo