chgb

Ensembl ID:
ENSDARG00000076500
ZFIN ID:
ZDB-GENE-070705-268
Description:
secretogranin-1 [Source:RefSeq peptide;Acc:NP_001121826]
Human Orthologue:
CHGB
Human Description:
chromogranin B (secretogranin 1) [Source:HGNC Symbol;Acc:1930]
Mouse Orthologue:
Chgb
Mouse Description:
chromogranin B Gene [Source:MGI Symbol;Acc:MGI:88395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17494 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113454 Nonsense 529 676 4 5
Genomic Location:
Chromosome 20 (position 45949336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGAGCAAGATGAGGATATTGCAAAGCGATACTGGAAGCCCACACAC[A/T]GATATCACCACAAAAAACATTATCGCAACAAGCGTGGCRACTCCATAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q51dsg6v