si:ch73-140j6.1

Ensembl ID:
ENSDARG00000076499
ZFIN ID:
ZDB-GENE-090312-168
Human Orthologue:
USP53
Human Description:
ubiquitin specific peptidase 53 [Source:HGNC Symbol;Acc:29255]
Mouse Orthologue:
Usp53
Mouse Description:
ubiquitin specific peptidase 53 Gene [Source:MGI Symbol;Acc:MGI:2139607]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19503 Nonsense Available for shipment Available now
sa39617 Nonsense Mutation detected in F1 DNA During 2017
sa32683 Nonsense Mutation detected in F1 DNA During 2017
sa39616 Nonsense Mutation detected in F1 DNA During 2017
sa14536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109714 Nonsense 29 1029 1 16
ENSDART00000145012 Nonsense 29 391 1 9
Genomic Location (Zv9):
Chromosome 1 (position 24768606)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25220377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGTCTGGCACAGGTGCAAGGAGTGGGACGGGGCTGAGCAAGTCCTA[T/A]CAGCCGGGCAGCATGATCTCTCTCGCTTTGACCAAAGGACTTCTAAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109714 Nonsense 476 1029 12 16
ENSDART00000145012   None 391 None 9
Genomic Location (Zv9):
Chromosome 1 (position 24721139)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25172910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCTGAATTGCTTACTAATGAAAATTATTTTGATTTCAGATATGACATA[T/A]CCACGCTTATCCTCTCCACCTGAGAATGGCCCAAGGTTTCATTGTGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109714 Nonsense 583 1029 12 16
ENSDART00000145012   None 391 None 9
Genomic Location (Zv9):
Chromosome 1 (position 24720820)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25172591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGTGCTGAGCGAACTAGAGCGACGACAGCAGCAGCAACAGCAGCAA[C/T]AGCGTGGAAGCCCTCGATGTGTGCGTCGATTCGCCCATGAGAGGGGGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39616
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109714 Nonsense 794 1029 15 16
ENSDART00000145012   None 391 None 9
Genomic Location (Zv9):
Chromosome 1 (position 24712908)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25164679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAAAGCCCATTACTGCGCCGCCTGGGCAAGATCAGCAGTTCAGAGTG[T/A]AACAGTTCTGATGAACTCACTAACCCTCTGTCAGAGCAGGAGGACAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109714 Nonsense 812 1029 15 16
ENSDART00000145012   None 391 None 9
Genomic Location (Zv9):
Chromosome 1 (position 24712854)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25164625
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTCTGATGAACTCACTAACCCTCTGTCAGAGCAGGAGGACAGTGCTTA[T/A]CGTTCCAGCACCAGTGAAGTCGCTCCACAKGAGTCACCGGGTCCCAATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link