golim4a

Ensembl ID:
ENSDARG00000076498
ZFIN ID:
ZDB-GENE-041026-2
Description:
Golgi integral membrane protein 4 [Source:RefSeq peptide;Acc:NP_001091662]
Human Orthologue:
GOLIM4
Human Description:
golgi integral membrane protein 4 [Source:HGNC Symbol;Acc:15448]
Mouse Orthologue:
Golim4
Mouse Description:
golgi integral membrane protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920374]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39514 Nonsense Mutation detected in F1 DNA During 2017
sa30471 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39513 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109191 Nonsense 43 645 1 15
ENSDART00000127546 Nonsense 10 520 1 14
Genomic Location (Zv9):
Chromosome Zv9_NA331 (position 76185)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150030.1 22314
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGAGCAGGAGACCAGGGATCATGGGCAACGGCGCGTGCTCCAGGAAG[C/T]AGAAGAAGATTTTCCAGTCTCTTTTTCTGGTCACGGTGGTTTTTGGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30471
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109191 Essential Splice Site 96 645 None 15
ENSDART00000127546 Essential Splice Site 63 520 None 14
Genomic Location (Zv9):
Chromosome Zv9_NA331 (position 76024)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150030.1 22153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGTCAAATATCAGCAGCACCAGGAGTCACTTTCGGCTCAGCTTCAAGG[T/C]ACGGTAAAAACACACTTCGTCGTGATGACGTCACATTGTAAAAAAACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109191 Essential Splice Site 120 645 2 15
ENSDART00000127546 Essential Splice Site 87 520 2 14
Genomic Location (Zv9):
Chromosome Zv9_NA331 (position 60474)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150030.1 6603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAGTCTCTTCAGAAGGAGCGAATTGACCATAAAAAAGCCAAAGAAG[G/A]CAAGTGCATTTTTAACAAATGACAACATCACTGACTTGATAATAATGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link