GSC2

Ensembl ID:
ENSDARG00000076491
Description:
goosecoid homeobox 2 [Source:HGNC Symbol;Acc:4613]
Human Orthologue:
GSC2
Human Description:
goosecoid homeobox 2 [Source:HGNC Symbol;Acc:4613]
Mouse Orthologue:
Gsc2
Mouse Description:
goosecoid homebox 2 Gene [Source:MGI Symbol;Acc:MGI:892006]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20327 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20327
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109446 Essential Splice Site 148 181 2 3
Genomic Location (Zv9):
Chromosome 5 (position 1385821)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 982899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGCGAACAACTGGCCCTCAAAACACAGCTGCGCGAGGAGAGAGTCGAG[G/A]TGATCAAGTACAATATTACTTATTGCGAACGTGCCTCATACAGGTGAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link