acp1

Ensembl ID:
ENSDARG00000076486
ZFIN IDs:
ZDB-GENE-030131-7490, ZDB-GENE-050327-12
Description:
low molecular weight phosphotyrosine protein phosphatase [Source:RefSeq peptide;Acc:NP_001014324]
Human Orthologue:
ACP1
Human Description:
acid phosphatase 1, soluble [Source:HGNC Symbol;Acc:122]
Mouse Orthologue:
Acp1
Mouse Description:
acid phosphatase 1, soluble Gene [Source:MGI Symbol;Acc:MGI:87881]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24384 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11199 Nonsense Available for shipment Available now
sa15878 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082647 Essential Splice Site 14 158 1 6
Genomic Location:
Chromosome 23 (position 35556382)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCAATATGGCGGCTTCCAGCGGAAAGTCGGTGTTATTCGTGTGCTTGG[G/A]TAAGAAATGCTATAAAATATCCCCTGACCTTCCTTAATGACATTACGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11199
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082647 Nonsense 156 158 6 6
ENSDART00000082647 Nonsense 156 158 6 6
Genomic Location:
Chromosome 23 (position 35588465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGACGGTGTATGAACAGTGTGCRAGATGCTGCAAAGYCTTCCTGGAG[C/T]AACATTCGTAACGCATACACACACANNNNNNCAAACACACACACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15878
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082647 Nonsense 156 158 6 6
ENSDART00000082647 Nonsense 156 158 6 6
Genomic Location:
Chromosome 23 (position 35588465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAYGGTGTATGAACAGTGTGCRAGATGCTGCAAAGYCTTCCTGGAG[C/T]AACATTCGTAACGCATACACACACANNNNNNCAAACACACACACACACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a68i14eg