LOC100332780

Ensembl ID:
ENSDARG00000076477
Human Orthologue:
ZMIZ1
Human Description:
zinc finger, MIZ-type containing 1 [Source:HGNC Symbol;Acc:16493]
Mouse Orthologue:
Zmiz1
Mouse Description:
zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24926 Nonsense Mutation detected in F1 DNA During 2014
sa2634 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa24926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113972 Nonsense 379 1054 7 20
Genomic Location:
Chromosome 12 (position 50224088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGTTATGGGGGCGGTCCTAATTATGCAGGTGGGATGGGCTTATCA[C/T]AGACACGCCCCCCTTCTGACCTCAGCCAACCAGCTGCTGCTGCTGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2634
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113972 Essential Splice Site 832 1054 16 20
Genomic Location:
Chromosome 12 (position 50229763)
KASP Assay ID:
554-2702.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGGAGGTGGACCAGTACATGTGGKGGATYCTGAACGCTTCACAGAGG[T/C]ACATGTGCCTTCNTTTCCCACACACTCAGCACACACTCACACTGGTTAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l33ogr33