LOC100332780

Ensembl ID:
ENSDARG00000076477
Human Orthologue:
ZMIZ1
Human Description:
zinc finger, MIZ-type containing 1 [Source:HGNC Symbol;Acc:16493]
Mouse Orthologue:
Zmiz1
Mouse Description:
zinc finger, MIZ-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:3040693]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24926 Nonsense Mutation detected in F1 DNA During 2016
sa35381 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2634 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa24926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113972 Nonsense 379 1054 7 20
Genomic Location (Zv9):
Chromosome 12 (position 50224088)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48783288
GRCz10 12 48837458
KASP Assay ID:
554-7603.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCAGTTATGGGGGCGGTCCTAATTATGCAGGTGGGATGGGCTTATCA[C/T]AGACACGCCCCCCTTCTGACCTCAGCCAACCAGCTGCTGCTGCTGCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113972 Essential Splice Site 738 1054 14 20
Genomic Location (Zv9):
Chromosome 12 (position 50229088)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48788288
GRCz10 12 48842458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGTGTGTGTGTGTATGTGTGTGTATGTGTGTGTGTGTGTGTCCTCA[G/T]TGAAGAAGAGTTTCAGCAGTGTGTGTGTGTCTGGACTCTCTGATGAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2634
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113972 Essential Splice Site 832 1054 16 20
Genomic Location (Zv9):
Chromosome 12 (position 50229763)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48788963
GRCz10 12 48843133
KASP Assay ID:
554-2702.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTGGAGGTGGACCAGTACATGTGGKGGATYCTGAACGCTTCACAGAGG[T/C]ACATGTGCCTTCNTTTCCCACACACTCAGCACACACTCACACTGGTTAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link