org

Ensembl ID:
ENSDARG00000076474
ZFIN ID:
ZDB-GENE-050208-584
Description:
oogenesis-related [Source:RefSeq peptide;Acc:NP_001093540]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14086 Essential Splice Site Available for shipment Available now
sa3190 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14086
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112722 Essential Splice Site 122 215 3 6
Genomic Location:
Chromosome 22 (position 21013173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTRGGTTATCCAGTCTGTACCAGCATCGGCTGTGCTGTGTCRCCAGG[T/C]ATGYCAATCACATTTGTTCNNNNAGACTAAAACCACACCTGCTGCCTTTNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3190
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112722 Nonsense 172 215 4 6
Genomic Location:
Chromosome 22 (position 21012953)
KASP Assay ID:
554-3304.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCTTACTCAGGAGCTGGCAGAGGAAGACCACGTCGCTGATCCCGACTA[T/A]GAGGTTTGCTTGATTTTTNNNNNNNCTGTTGGCATTTTGCGCTTGTCAGTTYTCGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sdfqigdj