si:ch211-251d10.4

Ensembl ID:
ENSDARG00000076473
ZFIN ID:
ZDB-GENE-030131-2957
Human Orthologue:
TRIM37
Human Description:
tripartite motif-containing 37 [Source:HGNC Symbol;Acc:7523]
Mouse Orthologue:
Trim37
Mouse Description:
tripartite motif-containing 37 Gene [Source:MGI Symbol;Acc:MGI:2153072]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2554 Nonsense Available for shipment Available now
sa34939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110986 Nonsense 59 957 4 24
ENSDART00000134255 Nonsense 59 957 5 25
Genomic Location (Zv9):
Chromosome 10 (position 33798623)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32899972
KASP Assay ID:
554-3033.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATATGTATGCTAATAACACTTSTAAATGTTGAATTCAGAGCTCCGCTA[C/T]AGCTSAGGGAACTGGTCAACTGTCGCTGGGCAGAGGAAGTGACTCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110986 Nonsense 841 957 21 24
ENSDART00000134255 Nonsense 841 957 22 25
Genomic Location (Zv9):
Chromosome 10 (position 33772679)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 32874028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGTTCAGCATCGCTGCTCTCAATGGAGCGTCTGCACCCGCCACCAAA[C/T]AGCACAGAGCTACAGCGATCGGGTAACGTATAAAAACAAGCCATCAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link