LOC567335

Ensembl ID:
ENSDARG00000076466
Human Orthologue:
MAML1
Human Description:
mastermind-like 1 (Drosophila) [Source:HGNC Symbol;Acc:13632]
Mouse Orthologue:
Maml1
Mouse Description:
mastermind like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890504]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11346 Nonsense Available for shipment Available now
sa16401 Essential Splice Site Available for shipment Available now
sa22440 Nonsense Available for shipment Available now
sa10050 Nonsense Available for shipment Available now
sa16266 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 413 1048 2 5
Genomic Location (Zv9):
Chromosome 14 (position 14085182)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16097123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCARCAGCATGWAGTTCAAAAGCCACCACAACAGAAAYCTCCACAACAG[C/T]AACCAACAAAGTTCCACCAACAGCCCAGCCACTCTACATCTTGGCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Essential Splice Site 574 1048 2 5
Genomic Location (Zv9):
Chromosome 14 (position 14084695)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16096636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGGCGCCTACMATGAACTTCAGACCAGCACATCTACCACATACTGCGG[T/C]AAGACTGGMTTCCCACTGCACACCTCACATTTATTTTTAWTTAGGAAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 630 1048 3 5
Genomic Location (Zv9):
Chromosome 14 (position 14072219)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16083950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAAATTCAGCTGATGAATCAACAGAAACAGTTTCAGCTCCAGAGA[C/T]AGATCATGGTTGAGCAGGTGCTTTTTTTCTTACCCTTTATCATTTTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10050
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 661 1048 4 5
Genomic Location (Zv9):
Chromosome 14 (position 14069385)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16081255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGCTGCAGAGACAWTTGACCCGTCCACCACCTCAGTACCAGGACCAA[C/T]AGAACCCGCAGGCCCAGCAGAACCCTTTYCAGCAGCAACAGCAGYAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108868 Nonsense 1023 1048 5 5
Genomic Location (Zv9):
Chromosome 14 (position 14067367)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 16079237
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACCCAATCGGGAGGCAGYTTGTCTGGGTTTCCAGCCGAGACTGATT[T/A]AGTGGATTCTCTGTTGAAGGATCAGTCGACACAACAGTGGATGGACGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link