LOC100148595

Ensembl ID:
ENSDARG00000076462
Human Orthologue:
C4orf31
Human Description:
chromosome 4 open reading frame 31 [Source:HGNC Symbol;Acc:26256]
Mouse Orthologue:
A930038C07Rik
Mouse Description:
RIKEN cDNA A930038C07 gene Gene [Source:MGI Symbol;Acc:MGI:1915419]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23090 Nonsense Mutation detected in F1 DNA During 2014
sa2920 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa23090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112096 Nonsense 51 568 1 3
Genomic Location:
Chromosome 17 (position 26419008)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACATGGCTGAGTGAGAACAGGGTTACACCGGTGCATCTGCCTAAAGGA[C/T]GAGCTCGCAGGTAAACACACGCATACAAACACACAGTGTACCTGTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2920
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112096 Essential Splice Site 54 568 2 3
Genomic Location:
Chromosome 17 (position 26425322)
KASP Assay ID:
554-3172.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTATCCTATTTGCTGTGTCTAATACACACTGATACGGATCTGTGTTTC[A/T]GGCTGTATTTCACACTAAAGAAGAAAGCTGATTTGCTGTCTGTTACTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ag3c8mwp