si:ch211-80e15.1

Ensembl ID:
ENSDARG00000076460
ZFIN ID:
ZDB-GENE-060607-12
Human Orthologue:
BAI1
Human Description:
brain-specific angiogenesis inhibitor 1 [Source:HGNC Symbol;Acc:943]
Mouse Orthologue:
Bai1
Mouse Description:
brain-specific angiogenesis inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1933736]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32102 Nonsense Mutation detected in F1 DNA During 2017
sa6442 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22909 Essential Splice Site Available for shipment Available now
sa42782 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085017   None 714 None 16
ENSDART00000113069 Nonsense 60 754 2 18
ENSDART00000133196   None 226 None 9
ENSDART00000137046   None 264 None 3
ENSDART00000144642   None 683 None 14

The following transcripts of ENSDARG00000076460 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40351883)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37615650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCCAGCTCTCTCTCGAGTCCACTAGAGATTGAGTTCTCACACCTTTA[C/A]AATGTAAGTCAGCCTGCCCTTTAAACCCATATGCTGCACCAAACAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085017 Essential Splice Site 45 714 None 16
ENSDART00000113069 Essential Splice Site 118 754 None 18
ENSDART00000133196 Essential Splice Site None 226 None 9
ENSDART00000137046   None 264 None 3
ENSDART00000144642 Essential Splice Site 43 683 None 14
ENSDART00000085017 Essential Splice Site 45 714 None 16
ENSDART00000113069 Essential Splice Site 118 754 None 18
ENSDART00000133196 Essential Splice Site None 226 None 9
ENSDART00000137046   None 264 None 3
ENSDART00000144642 Essential Splice Site 43 683 None 14

The following transcripts of ENSDARG00000076460 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40334134)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37632968
KASP Assay ID:
554-7970.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACAGACTCTCCACCTTCGCCATTTTAGCACGCCTCAATCCCGATGTGG[T/C]AAGTCGAGCCATTTCTTTTGTTCCCTTTAATGTCGAAGWACATGAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22909
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085017 Essential Splice Site 45 714 None 16
ENSDART00000113069 Essential Splice Site 118 754 None 18
ENSDART00000133196 Essential Splice Site None 226 None 9
ENSDART00000137046   None 264 None 3
ENSDART00000144642 Essential Splice Site 43 683 None 14
ENSDART00000085017 Essential Splice Site 45 714 None 16
ENSDART00000113069 Essential Splice Site 118 754 None 18
ENSDART00000133196 Essential Splice Site None 226 None 9
ENSDART00000137046   None 264 None 3
ENSDART00000144642 Essential Splice Site 43 683 None 14

The following transcripts of ENSDARG00000076460 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40334134)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37632968
KASP Assay ID:
554-7970.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACAGACTCTCCACCTTCGCCATTTTAGCACGCCTCAATCCCGATGTGG[T/A]AAGTCGAGCCATTTCTTTTGTTCCCTTTAATGTCGAAGAACATGAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085017 Nonsense 610 714 14 16
ENSDART00000113069 Nonsense 650 754 16 18
ENSDART00000133196   None 226 None 9
ENSDART00000137046   None 264 None 3
ENSDART00000144642 Nonsense 560 683 12 14

The following transcripts of ENSDARG00000076460 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 40292016)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37674877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTATTTATTTTTCTTATTTGCCCTTTTAGAGACGAAAATCACGCTA[T/A]GCAGAGCTGGACTTTGAGGTCAGTGTAATGTAAATCTTCCACAAATGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link