prdm2b

Ensembl ID:
ENSDARG00000076451
ZFIN ID:
ZDB-GENE-080613-3
Description:
PR domain containing 2 [Source:UniProtKB/TrEMBL;Acc:A5XCD8]
Human Orthologue:
PRDM2
Human Description:
PR domain containing 2, with ZNF domain [Source:HGNC Symbol;Acc:9347]
Mouse Orthologue:
Prdm2
Mouse Description:
PR domain containing 2, with ZNF domain Gene [Source:MGI Symbol;Acc:MGI:107628]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31835 Nonsense Available for shipment Available now
sa15771 Nonsense Available for shipment Available now
sa41846 Nonsense Mutation detected in F1 DNA During 2017
sa9522 Nonsense Available for shipment Available now
sa21919 Nonsense Available for shipment Available now
sa8982 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111907   None 227 None 4
ENSDART00000125431 Nonsense 33 1582 2 13
Genomic Location (Zv9):
Chromosome 11 (position 27140093)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25968918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTGTTTGCTCCAATAGAATTTTTCTGCATGTGTCTCTACAGGTGTCT[G/A]GGCATCTAGATTAATACCAAAAGGCAAACGATTTGGACCATTTGTAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111907   None 227 None 4
ENSDART00000125431 Nonsense 828 1582 10 13
Genomic Location (Zv9):
Chromosome 11 (position 27127714)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25956539
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACATGTAAAAAGAAAGAAACCCAATACTAGCATTTTAGAGAAAGTGK[T/A]AATGAATGAGTATGCWGGGCTAAACTCACCTGGAGAAGAAGAATCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111907   None 227 None 4
ENSDART00000125431 Nonsense 1006 1582 11 13
Genomic Location (Zv9):
Chromosome 11 (position 27126904)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25955729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGCAAATTGCATTCGCCACAGAGGAGCTCAGAGGCTGATGACAACT[T/G]AATTATAGAGGATGTAAGAAAAAAAGAGGAGATGGTAGACATAACTGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9522
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111907   None 227 None 4
ENSDART00000125431 Nonsense 1262 1582 12 13
Genomic Location (Zv9):
Chromosome 11 (position 27126117)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25954942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTTACCACACACAATATCCCCCAAACATTTAGCACTGCAATCCGCTG[T/A]ACCAAATGTGGAAACAGCTTTGACAACATGCCTGAGCTACACAAACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111907   None 227 None 4
ENSDART00000125431 Nonsense 1361 1582 12 13
Genomic Location (Zv9):
Chromosome 11 (position 27125822)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25954647
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCAGCCCTAAATAAGAAGAAAAACCAGCTTGTCCAGAAAGCTATATCA[C/T]AGAAGAACAAATTTGCAGCTTCTGCAAAGAAACCGACAGCCCGGGTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111907   None 227 None 4
ENSDART00000125431 Essential Splice Site 1496 1582 12 13
Genomic Location (Zv9):
Chromosome 11 (position 27125415)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25954240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTACWAAGAGGCCATCCTCAAATGTAGTCAACGCTGCCCCACAAATTAA[G/A]AAAGGCAAAAAAAGCAATGAGMCATTGACTTTTATAACTCCTGCTGTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link