KBTBD13 (1 of 3)

Ensembl ID:
ENSDARG00000076449
Description:
kelch repeat and BTB (POZ) domain containing 13 [Source:HGNC Symbol;Acc:37227]
Human Orthologue:
KBTBD13
Human Description:
kelch repeat and BTB (POZ) domain containing 13 [Source:HGNC Symbol;Acc:37227]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40845 Nonsense Mutation detected in F1 DNA During 2016
sa20871 Nonsense Mutation detected in F1 DNA During 2016
sa14364 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110452 Nonsense 173 410 2 2
Genomic Location:
Chromosome 7 (position 14615669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACATTTGCCTCTCAACGCCAGCACAACCATGGCAGGAGTTACGGCTT[T/A]AGACAATAAGATCTACATTGTCGGAGGAGTTTATGATATGACTAATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110452 Nonsense 181 410 2 2
Genomic Location:
Chromosome 7 (position 14615646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAACCATGGCAGGAGTTACGGCTTTAGACAATAAGATCTACATTGTC[G/T]GAGGAGTTTATGATATGACTAATAAAGTGGTGGATTCGGGATTCTGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110452 Nonsense 244 410 2 2
Genomic Location:
Chromosome 7 (position 14615455)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYAATTGGCGGAGAATATGAAAAAAGCGTMATGTCTTCWGTGGAAAAGTA[T/A]CRAGTCTCATCGGATACYTGGAGCTTTGTTGCGCATCTACCAAGAGCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link