serpinf2

Ensembl ID:
ENSDARG00000076448
ZFIN ID:
ZDB-GENE-060822-1
Human Orthologue:
SERPINF2
Human Description:
serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member
Mouse Orthologue:
Serpinf2
Mouse Description:
serine (or cysteine) peptidase inhibitor, clade F, member 2 Gene [Source:MGI Symbol;Acc:MGI:107173]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15059 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109904 Essential Splice Site 132 457 3 7
ENSDART00000145150 Essential Splice Site 132 457 4 8
Genomic Location (Zv9):
Chromosome 21 (position 38934481)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 40074546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACAGCCAAAGCTGTCAAGATGGCATCTCGTCTGTACCTCGTACCAGG[T/C]GAGGTTTTGTTTTTTTCAGRCTATACCTGGWTAATCRTGTTTAGATTTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link