ENSDARG00000076443

Ensembl ID:
ENSDARG00000076443
Human Orthologue:
MGEA5
Human Description:
meningioma expressed antigen 5 (hyaluronidase) [Source:HGNC Symbol;Acc:7056]
Mouse Orthologue:
Mgea5
Mouse Description:
meningioma expressed antigen 5 (hyaluronidase) Gene [Source:MGI Symbol;Acc:MGI:1932139]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15559 Essential Splice Site Available for shipment Available now
sa14298 Nonsense Available for shipment Available now
sa38606 Nonsense Mutation detected in F1 DNA During 2016
sa18041 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110279 Essential Splice Site 18 839 1 19
Genomic Location (Zv9):
Chromosome 7 (position 25157978)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23719730
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTATGGGCGACCCTGGTCAATGGAACAAAGGAAGGTACTATTTCAGTGG[T/G]GAGTAYTGKATCTGAACACACTTTTGAATGGAATGWGGATTKCTTTTTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110279 Nonsense 69 839 3 19
Genomic Location (Zv9):
Chromosome 7 (position 25149870)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23711622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAAGGCTCTAGTTTGTGAGGCCCGATCGAGGGGTCTTACGTTTGTATA[C/A]GCTCYTTCCCCGGGACAGGACATYGTCTTCTCCAGCTCTTGTGACCTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110279 Nonsense 634 839 15 19
Genomic Location (Zv9):
Chromosome 7 (position 25141565)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23703317
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCAGCAGTGAGTTGTTCAGTCACCCTCCTCCTCTATTCCCCACCTCT[C/T]GACTCTACAACATACGACCATTCTTGCAAAAAGACAAGGTGACTCAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110279 Essential Splice Site 677 839 16 19
Genomic Location (Zv9):
Chromosome 7 (position 25141339)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 23703091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGAGGTCAGGATGCTGCCTTCTGCCRTCCAGACCTAATTGGAGACAGG[T/A]AAGACTTAGAGTGCTCTCAAGCMTATTYCAGCCCCTKTRTAACAATTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link