ppp4cb

Ensembl ID:
ENSDARG00000076439
ZFIN ID:
ZDB-GENE-080219-32
Description:
Serine/threonine-protein phosphatase 4 catalytic subunit B [Source:UniProtKB/Swiss-Prot;Acc:A9JRC7]
Human Orthologue:
PPP4C
Human Description:
protein phosphatase 4, catalytic subunit [Source:HGNC Symbol;Acc:9319]
Mouse Orthologue:
Ppp4c
Mouse Description:
protein phosphatase 4, catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1891763]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19020 Nonsense Mutation detected in F1 DNA During 2017
sa11029 Nonsense Available for shipment Available now
sa1713 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114857 Nonsense 52 307 4 9
ENSDART00000114857 Nonsense 52 307 4 9
Genomic Location (Zv9):
Chromosome 12 (position 4653809)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3936531
KASP Assay ID:
2260-4833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGCATCTCTACGAGAAGTAAATGGTTTATTTTTGTCTCCAGGTGTG[T/A]GGTGACATCCACGGGCAGTTTTATGACCTGAAGGAATTGTTTAGGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11029
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114857 Nonsense 52 307 4 9
ENSDART00000114857 Nonsense 52 307 4 9
Genomic Location (Zv9):
Chromosome 12 (position 4653809)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3936531
KASP Assay ID:
2260-4833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAGCATCTCTAYGWGAAGTAAATKGTTTATTTTTGTCTCCAGGTGTG[T/A]GGTGACATYCACGGGCAGTTTTATGACCTGAAGGAATTGTTTAGGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114857 Essential Splice Site 265 307 8 9
Genomic Location (Zv9):
Chromosome 12 (position 4648113)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3930835
KASP Assay ID:
554-1659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACGAGACCGTTCTCACTGTGTGGTCTGCGCCCAACTACTGCTACAG[G/A]TGGGTTTGATGTGCAGCCAATGAGATGAGAGATGCGTTCATGAAGCCTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link