A0PJR2_DANRE

Ensembl ID:
ENSDARG00000076431
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A0PJR2]
Mouse Orthologue:
Ppp1r9b
Mouse Description:
protein phosphatase 1, regulatory subunit 9B Gene [Source:MGI Symbol;Acc:MGI:2387581]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22041 Nonsense Available for shipment Available now
sa41970 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22041
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109521 Nonsense 468 801 2 10
Genomic Location (Zv9):
Chromosome 12 (position 10483255)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9706749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGACAGGAGGAATGATGACGTGGACCCCATGGCTGCTTCTGCTGAGTA[T/A]GAGCTGGAGAAACGTGTGGAAAGGCTGGACCTGTTCCCCGTCGAGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109521 Nonsense 529 801 4 10
Genomic Location (Zv9):
Chromosome 12 (position 10724509)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9711931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAGGTCATTTCTCAATGTCATGCTGCTTATTTTTCCCATTCAGGATA[C/T]AAGTGAATGATTTGATTGTGGAGGTGGATGGAACAAGCCTGGTTGGTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link