SHROOM2 (1 of 2)

Ensembl ID:
ENSDARG00000076416
Description:
shroom family member 2 [Source:HGNC Symbol;Acc:630]
Human Orthologue:
SHROOM2
Human Description:
shroom family member 2 [Source:HGNC Symbol;Acc:630]
Mouse Orthologue:
Shroom2
Mouse Description:
shroom family member 2 Gene [Source:MGI Symbol;Acc:MGI:107194]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2290 Essential Splice Site F2 line generated During 2017
sa31513 Nonsense Available for shipment Available now
sa38554 Nonsense Mutation detected in F1 DNA During 2017
sa943 Nonsense F2 line generated During 2017
sa11469 Nonsense Available for shipment Available now
sa40712 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2290
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Essential Splice Site 245 1324 2 12
Genomic Location (Zv9):
Chromosome 6 (position 30120613)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30445508
KASP Assay ID:
554-2570.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGATAGCTTTGCAGCTACCAAGGTTCAYGAGAAGGGTCTGATCACAGG[T/C]ACTTCAGAGGGCCTTGGTGGTCATTCTCAAGTAAAGCCTCAAGCGAAACC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 508 1324 4 12
Genomic Location (Zv9):
Chromosome 6 (position 30121652)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30446547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACATGAAGCCCTTGACAGTCTCAGTAGTAAACAGGTTAGACGGAATGAC[C/T]GATTTGCCACCACTTTGCGCAACGAGATCCAGATGAGAAGGGCGCATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38554
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 801 1324 4 12
Genomic Location (Zv9):
Chromosome 6 (position 30122532)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30447427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAGAGCGACGGAGTAACCCCACCTGTGTGCATGAAAGATCTAGATCCT[C/A]ACCTTCTGCTGACTTTTATGGGCAGGTTTGTGACCTTGTTTAAATGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa943
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 831 1324 5 12
Genomic Location (Zv9):
Chromosome 6 (position 30123003)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30447898
KASP Assay ID:
554-0848.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAAAGAAGTCAGCTGACTGTTTCAAATCTGAAAAGAGTCCTTGCCAA[C/T]AGGACAAGAATAGTACAAGGTAGGTGCTGTTTCATTTTCCCATTGCACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Nonsense 1075 1324 8 12
Genomic Location (Zv9):
Chromosome 6 (position 30129942)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30454837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGAGGGGATTTTCCCTCAAGGAGATCAGCTACTGGAGGAGGCCYAA[C/T]AGCGYAGGAARGCTCAACCTAAACCACTCTCCCCTCGAAACTCTGTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40712
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108943 Essential Splice Site 1146 1324 11 12
Genomic Location (Zv9):
Chromosome 6 (position 30139445)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 30463312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTCCTACCTACCAGTTGACTGAATCTAATGGCATTCTCTGTCTTTGC[A/T]GCACGAGTTGATTGAAAGTCTCAGTAAGAAGTTGCAGGTCTTAAAAGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link