espn

Ensembl ID:
ENSDARG00000076414
ZFIN ID:
ZDB-GENE-081105-173
Description:
hypothetical protein LOC567061 [Source:RefSeq peptide;Acc:NP_001116754]
Human Orthologue:
ESPN
Human Description:
espin [Source:HGNC Symbol;Acc:13281]
Mouse Orthologue:
Espn
Mouse Description:
espin Gene [Source:MGI Symbol;Acc:MGI:1861630]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3670 Nonsense Mutation detected in F1 DNA During 2014
sa10717 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111071 None None 870 None 14
ENSDART00000139422 Nonsense 1152 1476 12 12
ENSDART00000146631 None None 873 None 13

The following transcripts of ENSDARG00000076414 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 49231328)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGGAAGACTCTAAGCGTTGAAGACAACAACTCCCATTCCTTGTATTA[T/A]CACAACCTAGCTAAGCCAGAYGATACCATGCAAACAGAGGATGATCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111071 Nonsense 805 870 12 14
ENSDART00000139422 None None 1476 None 12
ENSDART00000146631 Nonsense 812 873 12 13

The following transcripts of ENSDARG00000076414 do not overlap with this mutation:

Genomic Location:
Chromosome 8 (position 49239783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGACAGRCTGAAGAAGAGGCGGCTCGTCTGGCATCCTTACCTGCGT[G/A]GAGGAGAGACATCATGAAGAAAAAATTRGAGGAAGAGAAGTGAGTTAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kgr5xix6