CORIN (1 of 2)

Ensembl ID:
ENSDARG00000076412
Description:
corin, serine peptidase [Source:HGNC Symbol;Acc:19012]
Human Orthologue:
CORIN
Human Description:
corin, serine peptidase [Source:HGNC Symbol;Acc:19012]
Mouse Orthologue:
Corin
Mouse Description:
corin Gene [Source:MGI Symbol;Acc:MGI:1349451]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14780 Nonsense Available for shipment Available now
sa3237 Essential Splice Site F2 line generated During 2016
sa37793 Nonsense Mutation detected in F1 DNA During 2016
sa37792 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Nonsense 71 275 2 6
Genomic Location:
Chromosome 23 (position 44220454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGGTGGTTCTGGGCATAAATAATCTGGATCATCCGTCTCCATACATG[C/T]AAACGCGGCGAGTCAAGAGCATCATCGTTCACTCGCGCTACAATCGTGCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3237
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Essential Splice Site 141 275 3 6
Genomic Location:
Chromosome 23 (position 44220114)
KASP Assay ID:
554-3275.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TMTGAGCACAAGGTGANCAGGCACTTTTTTTTCTTTAATAACTGTTTTAG[G/A]TAATTCTACAGTGAGTCTGTGGTGTCAGTAGTGAGCCTTTGACATCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37793
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Nonsense 177 275 4 6
Genomic Location:
Chromosome 23 (position 44217948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTACTTTGACATGAAGACCATCACCTCTCGCATGCTCTGTGCTGGATA[C/A]GAGGCCGGAACCATCGACTCCTGTATGGTGAGTGAGGCTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Essential Splice Site 187 275 5 6
Genomic Location:
Chromosome 23 (position 44217770)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCATACTTAATCATGAATGTGCACGTGTTTGTCTGTTTATATGTGTTC[A/G]GGGTGACAGTGGCGGTCCGCTGGTCTGCGAGGAGGACGATGGACACTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link