CORIN (1 of 2)

Ensembl ID:
ENSDARG00000076412
Description:
corin, serine peptidase [Source:HGNC Symbol;Acc:19012]
Human Orthologue:
CORIN
Human Description:
corin, serine peptidase [Source:HGNC Symbol;Acc:19012]
Mouse Orthologue:
Corin
Mouse Description:
corin Gene [Source:MGI Symbol;Acc:MGI:1349451]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14780 Nonsense Available for shipment Available now
sa3237 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa14780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Nonsense 71 275 2 6
Genomic Location:
Chromosome 23 (position 44220454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGGTGGTTCTGGGCATAAATAATCTGGATCATCCGTCTCCATACATG[C/T]AAACGCGGCGAGTCAAGAGCATCATCGTTCACTCGCGCTACAATCGTGCS
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3237
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108892 Essential Splice Site 141 275 3 6
Genomic Location:
Chromosome 23 (position 44220114)
KASP Assay ID:
554-3275.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TMTGAGCACAAGGTGANCAGGCACTTTTTTTTCTTTAATAACTGTTTTAG[G/A]TAATTCTACAGTGAGTCTGTGGTGTCAGTAGTGAGCCTTTGACATCAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0omgf2yp