si:ch211-149a19.5

Ensembl ID:
ENSDARG00000076406
ZFIN ID:
ZDB-GENE-081104-129
Description:
hypothetical protein LOC100149204 [Source:RefSeq peptide;Acc:NP_001138290]
Human Orthologue:
GGCT
Human Description:
gamma-glutamylcyclotransferase [Source:HGNC Symbol;Acc:21705]
Mouse Orthologue:
Ggct
Mouse Description:
gamma-glutamyl cyclotransferase Gene [Source:MGI Symbol;Acc:MGI:95700]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43201 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43201
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113392 Essential Splice Site 130 171 3 4
Genomic Location (Zv9):
Chromosome 19 (position 2004032)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 1930772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAGATGAACAACTTCACACCCTGTTCACCTTCACCACAGTATAAAAAG[G/A]TAGAGTTTACCACTCATCAGACATTAACCAGCGTCTTAAAGTGAATCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link