LOC571725

Ensembl ID:
ENSDARG00000076404
Human Orthologue:
MCTP1
Human Description:
multiple C2 domains, transmembrane 1 [Source:HGNC Symbol;Acc:26183]
Mouse Orthologue:
Mctp1
Mouse Description:
multiple C2 domains, transmembrane 1 Gene [Source:MGI Symbol;Acc:MGI:1926021]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10830 Nonsense Available for shipment Available now
sa18034 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113985 Nonsense 41 726 2 21
Genomic Location (Zv9):
Chromosome 5 (position 52322239)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 49989435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRAACTTCCTCCRTTGCCWAAGCCAAGGATGTATCAGCTGGACATTRTGT[T/A]GAAGAAGGGCAATAATCTGGCCAWYAGGGACAGAGGAGGTATGTGCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18034
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113985 Essential Splice Site 233 726 7 21
Genomic Location (Zv9):
Chromosome 5 (position 52268665)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 49935861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCCTTATGTCAAATTCAGAMWGGGACATCAAAAGTACAAAAGTAAGG[T/A]ATGGGYCATGAGCTGTATTCCAGTTACTTGTTCTATAGAGAATTGCTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Genome-wide association and meta-analysis of bipolar disorder in individuals of European ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link