LOC564883

Ensembl ID:
ENSDARG00000076401
Human Orthologue:
CACNG3
Human Description:
calcium channel, voltage-dependent, gamma subunit 3 [Source:HGNC Symbol;Acc:1407]
Mouse Orthologue:
Cacng3
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1859165]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25255 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110126 Essential Splice Site 70 309 1 4
Genomic Location:
Chromosome 3 (position 35384719)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGAAGTCATGACCCATTCAGGGCTTTGGAGAACCTGCTGTCTAGAAG[G/A]TAAGGCGTCTCATGTGCTTCTGAAAGTGAAAGTACTCCTATCTATCTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/svsokdew