LOC564883

Ensembl ID:
ENSDARG00000076401
Human Orthologue:
CACNG3
Human Description:
calcium channel, voltage-dependent, gamma subunit 3 [Source:HGNC Symbol;Acc:1407]
Mouse Orthologue:
Cacng3
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1859165]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25255 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33230 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110126 Essential Splice Site 70 309 1 4
Genomic Location (Zv9):
Chromosome 3 (position 35384719)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35169915
KASP Assay ID:
554-7828.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGGAAGTCATGACCCATTCAGGGCTTTGGAGAACCTGCTGTCTAGAAG[G/A]TAAGGCGTCTCATGTGCTTCTGAAAGTGAAAGTACTCCTATCTATCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110126 Essential Splice Site 146 309 3 4
Genomic Location (Zv9):
Chromosome 3 (position 35456123)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35241319
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGACACAATGTCATCCTCAGTGCCGGAATCTTCTTTGTCTCTGCTGG[T/A]AAGAGATTAAAACCACTGCATCACTGCTAGCAAGCTCCGTTTGTTTATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link