TXNDC6

Ensembl ID:
ENSDARG00000076395
Description:
thioredoxin domain containing 6 [Source:HGNC Symbol;Acc:21343]
Human Orthologue:
TXNDC6
Human Description:
thioredoxin domain containing 6 [Source:HGNC Symbol;Acc:21343]
Mouse Orthologue:
1600029I14Rik
Mouse Description:
RIKEN cDNA 1600029I14 gene Gene [Source:MGI Symbol;Acc:MGI:1917047]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3717 Nonsense Mutation detected in F1 DNA During 2016
sa18969 Nonsense Mutation detected in F1 DNA During 2016
sa34777 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa3717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113216 Nonsense 207 532 11 19
ENSDART00000113216 Nonsense 207 532 11 19
Genomic Location:
Chromosome 9 (position 54106508)
KASP Assay ID:
2260-2590.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCGCAYGAGGAGCGAACGCTRACTGAAGCAGAAGCTCAGGACTTCTA[T/A]CAACACAAAGCCGCGGAGGTAAATGAAKGAATCCTCTAAAAATAGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113216 Nonsense 207 532 11 19
ENSDART00000113216 Nonsense 207 532 11 19
Genomic Location:
Chromosome 9 (position 54106508)
KASP Assay ID:
2260-2590.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCGCATGAGGAGCGAACGCTAACTGAAGCAGAAGCTCAGGACTTCTA[T/A]CAACACAAAGCCGCGGAGGTAAATGAATGAATCCTCTAAAAATAGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113216 Nonsense 343 532 15 19
Genomic Location:
Chromosome 9 (position 54056622)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAATGTGTTTTAGAGGAAATCCTGAGCCGCATCCGTCAAGCTGGTTTC[A/T]GAGTGGCCATGCAGAAAGAGCTGATGCTGACGGAGGAGCAGGTGCGACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link