TXNDC6

Ensembl ID:
ENSDARG00000076395
Description:
thioredoxin domain containing 6 [Source:HGNC Symbol;Acc:21343]
Human Orthologue:
TXNDC6
Human Description:
thioredoxin domain containing 6 [Source:HGNC Symbol;Acc:21343]
Mouse Orthologue:
1600029I14Rik
Mouse Description:
RIKEN cDNA 1600029I14 gene Gene [Source:MGI Symbol;Acc:MGI:1917047]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3717 Nonsense Mutation detected in F1 DNA During 2014
sa18969 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113216 Nonsense 207 532 11 19
ENSDART00000113216 Nonsense 207 532 11 19
Genomic Location:
Chromosome 9 (position 54106508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGCGCAYGAGGAGCGAACGCTRACTGAAGCAGAAGCTCAGGACTTCTA[T/A]CAACACAAAGCCGCGGAGGTAAATGAAKGAATCCTCTAAAAATAGCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113216 Nonsense 207 532 11 19
ENSDART00000113216 Nonsense 207 532 11 19
Genomic Location:
Chromosome 9 (position 54106508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCGCATGAGGAGCGAACGCTAACTGAAGCAGAAGCTCAGGACTTCTA[T/A]CAACACAAAGCCGCGGAGGTAAATGAATGAATCCTCTAAAAATAGCCTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/iy6r8ebg