TXNDC6

Ensembl ID:
ENSDARG00000076395
Description:
thioredoxin domain containing 6 [Source:HGNC Symbol;Acc:21343]
Human Orthologue:
TXNDC6
Human Description:
thioredoxin domain containing 6 [Source:HGNC Symbol;Acc:21343]
Mouse Orthologue:
1600029I14Rik
Mouse Description:
RIKEN cDNA 1600029I14 gene Gene [Source:MGI Symbol;Acc:MGI:1917047]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34777 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113216 Nonsense 343 532 15 19
Genomic Location (Zv9):
Chromosome 9 (position 54056622)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52796582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAATGTGTTTTAGAGGAAATCCTGAGCCGCATCCGTCAAGCTGGTTTC[A/T]GAGTGGCCATGCAGAAAGAGCTGATGCTGACGGAGGAGCAGGTGCGACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link