si:dkey-217f16.6

Ensembl ID:
ENSDARG00000076389
ZFIN ID:
ZDB-GENE-091117-15
Human Orthologue:
TNRC6B
Human Description:
trinucleotide repeat containing 6B [Source:HGNC Symbol;Acc:29190]
Mouse Orthologue:
Tnrc6b
Mouse Description:
trinucleotide repeat containing 6b Gene [Source:MGI Symbol;Acc:MGI:2443730]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19928 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123512 Essential Splice Site 71 381 2 9
ENSDART00000137102   None 278 None 7
Genomic Location (Zv9):
Chromosome 3 (position 3675374)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 3136795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGCCATGCTCGGCGGCATTAATCCACACATGCAGCAGTTCCAGCTGG[T/G]ATGGCTTATTTTGAGTCTTGTAGTTGCAGTTATTGTAGAAGCGTTGTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study of northwestern Europeans involves the C-type natriuretic peptide signaling pathway in the etiology of human height variation. (View Study)
  • Prostate cancer: A meta-analysis of genome-wide association studies to identify prostate cancer susceptibility loci associated with aggressive and non-aggressive disease. (View Study)
  • Prostate cancer: Sequence variants at 22q13 are associated with prostate cancer risk. (View Study)
  • Prostate cancer (gene x gene interaction): A genome-wide search for loci interacting with known prostate cancer risk-associated genetic variants. (View Study)
  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link