ARHGEF5

Ensembl ID:
ENSDARG00000076383
Description:
Rho guanine nucleotide exchange factor (GEF) 5 [Source:HGNC Symbol;Acc:13209]
Human Orthologue:
ARHGEF5
Human Description:
Rho guanine nucleotide exchange factor (GEF) 5 [Source:HGNC Symbol;Acc:13209]
Mouse Orthologue:
Arhgef5
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 5 Gene [Source:MGI Symbol;Acc:MGI:1858952]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22801 Nonsense Mutation detected in F1 DNA During 2014
sa5888 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14719 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Nonsense 572 1489 1 14
Genomic Location:
Chromosome 16 (position 19678908)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACAGAATAATATCAGCAGATGATGGATTTGTGACAGTCTCTAGTGGA[G/T]GAGATATTGAAGACTGTATGGATTTCCGGAATGGTGAAGTTCCCACTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Essential Splice Site 964 1489 3 14
Genomic Location:
Chromosome 16 (position 19683636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCAGGAAACTTGGGAGGACAAAAAAGAGGAGTTCTAAATACTTTAG[T/A]AGGTGTTTGTGTTTTTTCATATACATGGCAAACCCTGTCTATTACAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14719
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114437 Nonsense 1379 1489 11 14
Genomic Location:
Chromosome 16 (position 19692179)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATTCCTTACAGAAAAACCTGTTCCGTCTGCACATGCCACAAAAAGCCT[T/A]GCTTTTGCGAACAGATACCCAGTAAGTATGCMATTGTGCTTGCTTGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wv93ln23