NP_001108353.1

Ensembl ID:
ENSDARG00000076380
Description:
heterogeneous nuclear ribonucleoprotein A0, like [Source:RefSeq peptide;Acc:NP_001108353]
Human Orthologue:
GZF1
Human Description:
GDNF-inducible zinc finger protein 1 [Source:HGNC Symbol;Acc:15808]
Mouse Orthologue:
Gzf1
Mouse Description:
GDNF-inducible zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921783]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29449 Nonsense Mutation detected in F1 DNA During 2017
sa9486 Essential Splice Site Available for shipment Available now
sa37146 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29449
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113806 Nonsense 208 763 1 6
Genomic Location (Zv9):
Chromosome 20 (position 45817445)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45666123
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACGGAAATCCTTGATGAACCTGACAATGCAGAAGGAGAAGAAGAGCAA[C/T]GAATAGCAGAACATCCGGAAGCAGAATCATCAAAGAATGCATTGGATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113806 Essential Splice Site 293 763 1 6
Genomic Location (Zv9):
Chromosome 20 (position 45817703)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45666381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGCAGCCGCTATTTCTACTACGAGAAGAGCTATCTGAAACACTTAAAG[G/A]TGGGWTTACGATGGTMTCAAAMTTTTGCTTGTGTTTAATTNNNNNNGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113806 Nonsense 461 763 4 6
Genomic Location (Zv9):
Chromosome 20 (position 45823226)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 45671904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCATTCATGTGTGAGAACTGTGGGAAGAGCTTCGCATCTAAAGAATA[T/G]CTGAAGCATCACAACAGAATCCATTCGGGCTCCAGACCCTACAAATGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link