SHROOM2 (2 of 2)

Ensembl ID:
ENSDARG00000076371
Description:
shroom family member 2 [Source:HGNC Symbol;Acc:630]
Human Orthologue:
SHROOM2
Human Description:
shroom family member 2 [Source:HGNC Symbol;Acc:630]
Mouse Orthologue:
Shroom2
Mouse Description:
shroom family member 2 Gene [Source:MGI Symbol;Acc:MGI:107194]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4439 Nonsense F2 line generated During 2017
sa6222 Nonsense Mutation detected in F1 DNA During 2017
sa35165 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa4439
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111271 Nonsense 117 1425 3 9
Genomic Location (Zv9):
Chromosome 11 (position 45287307)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43889574
KASP Assay ID:
554-3547.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAAATATGGAAAGCGTAGAGCCCTCATCTCATGCTTTCTCAAAAGAA[C/T]AACCTTTAACAAGCAAACCCAATGGAGGAGCAGATCACGAGGTGCTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111271 Nonsense 178 1425 3 9
Genomic Location (Zv9):
Chromosome 11 (position 45287124)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43889391
KASP Assay ID:
554-5084.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGGGGTGTTTTACAGAGGCGATCTAACAGTYCCGAGTGACTGCCAC[A/T]GATACCTGCAGATCCCCATAGGCAATGGGGGACGAGTGAGTCCCAGTGTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111271 Nonsense 715 1425 3 9
Genomic Location (Zv9):
Chromosome 11 (position 45285513)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 43887780
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTGAAGATAAAGCTGGCGGGTCTTTTGCAGACCGATACAAGTTCTTT[G/T]AAGGTTCTGGCAAAGCGGTTGTCCAAAAGCCCATTCCAAAGCAGTCCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link