si:dkey-178k16.1

Ensembl ID:
ENSDARG00000076364
ZFIN ID:
ZDB-GENE-090312-61
Human Orthologue:
EPB41L1
Human Description:
erythrocyte membrane protein band 4.1-like 1 [Source:HGNC Symbol;Acc:3378]
Mouse Orthologue:
Epb4.1l1
Mouse Description:
erythrocyte protein band 4.1-like 1 Gene [Source:MGI Symbol;Acc:MGI:103010]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10149 Nonsense Available for shipment Available now
sa14559 Nonsense Available for shipment Available now
sa29886 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37633 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24269 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10149
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Nonsense 77 877 3 22
ENSDART00000134652 Nonsense 77 518 4 14
ENSDART00000143481   None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12010256)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11969058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGTGCTCTTTYTCTGCTCATCAATCAAAACAGAAGCTCTGTAAAGGA[C/T]AAGTGTTACTGGATATGGTGTGTGAACATCTCAACCTGTTGGAGAAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Nonsense 124 877 5 22
ENSDART00000134652 Nonsense 124 518 6 14
ENSDART00000143481   None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12004037)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11962839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATCTGTTGAACACRAGCTTGTRTTTGATTGTTTTTAGTKGGTCCTTG[G/A]CATTTCTCCTTTGCTGTCAAGTTCTATCCCCCTGATCCGTCTCAGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Essential Splice Site 146 877 6 22
ENSDART00000134652 Essential Splice Site 146 518 7 14
ENSDART00000143481   None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 12002601)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11961403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATAATTTGTTAAGTTAGTTAATTTGTTGCATGTGTGTTTGCATGGGC[A/T]GGTATTACCTGTGTCTGCAGCTGAGGGAGGACATTCTGTCAGGTCGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Essential Splice Site 532 877 14 22
ENSDART00000134652   None 518 None 14
ENSDART00000143481   None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11981760)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11940562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACGTCTCTCTGGAGCCTCATCTGGTAGCACTCCGGAGAAAAAATCT[G/T]TGAGTAATTGGTACCAGCAAGGGGAAGTATTTTGTGGTGACTTCAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110627 Nonsense 716 877 17 22
ENSDART00000134652   None 518 None 14
ENSDART00000143481   None 140 None 6

The following transcripts of ENSDARG00000076364 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 11977256)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 11936058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTACAGAACAAGCTAATGCCCAGTCGATGAGACGGGAGAGCTCTGAAT[C/A]ACCCCCAATCCACCCTCTCAGCAGAGAGAGCAGTGAAATCATTGCCTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link