LOC559650

Ensembl ID:
ENSDARG00000076362
Human Orthologue:
C14orf101
Human Description:
chromosome 14 open reading frame 101 [Source:HGNC Symbol;Acc:20185]
Mouse Orthologue:
6720456H20Rik
Mouse Description:
RIKEN cDNA 6720456H20 gene Gene [Source:MGI Symbol;Acc:MGI:2443219]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23165 Nonsense Mutation detected in F1 DNA During 2014
sa16408 Nonsense Available for shipment Available now
sa23166 Nonsense Mutation detected in F1 DNA During 2014
sa23167 Nonsense Mutation detected in F1 DNA During 2014
sa14447 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113427 Nonsense 53 684 3 16
Genomic Location:
Chromosome 17 (position 44177462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGTTTACAGTAGTGTTTTTTCCCCACAGGTGGCTCATCCTCCAGGATA[T/A]CCTCTCTTCACCATGATGTCTTCTCTGATGCTCTCCCTGCTGCCTCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113427 Nonsense 178 684 5 16
Genomic Location:
Chromosome 17 (position 44208886)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCTGTTCTGTGGGCTGAGCCTGTGTAATCAGCACACACTAGTTCTGTA[T/A]GTTGTCGTYATAATTCCCTGGGCCCTACTGCATCTCTATACACATAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113427 Nonsense 375 684 10 16
Genomic Location:
Chromosome 17 (position 44217744)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGACTGGTCATCTAGGCAAAGGGACGGTGTGGAACACAGGAGCCT[G/A]GATACTCACTGCAGGCCTCATATCACACATGATCAGCTTAAACCACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23167
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113427 Nonsense 506 684 13 16
Genomic Location:
Chromosome 17 (position 44229679)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGGGCTTGTGTACAGCAGGCCAGTGTTTGTATGTATTGGTCTCACT[G/T]AGGGTGACCCCAGCTGGGAGGGGAGTTTCTCTCGTTGGCCCTGGGGCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113427 Nonsense 590 684 15 16
Genomic Location:
Chromosome 17 (position 44233692)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGACWGCCTTTTTCCTGTTTGACCTKGCTGAGAATGCGGAGAAAGAA[C/T]AGCAGGGTCGCCTTTACGAGATTTCCTACAAAGTAAGTTAKACATTTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hsdsaj5r