LOC100333855

Ensembl ID:
ENSDARG00000076361
Human Orthologue:
B4GALNT2
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 2 [Source:HGNC Symbol;Acc:24136]
Mouse Orthologue:
B4galnt2
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 2 Gene [Source:MGI Symbol;Acc:MGI:1342058]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5995 Nonsense Mutation detected in F1 DNA During 2016
sa37993 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111231 Nonsense 119 481 4 11
Genomic Location:
Chromosome 25 (position 5649780)
KASP Assay ID:
554-3719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAAAATGACGTGCTTATTCTGGCTCCTGCAAACACTCCACTCCAGTA[T/G]CCAATTAAAGGCTTCAGAGTCACTCCTATGAATAAAACAYGCATTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111231 Nonsense 402 481 10 11
Genomic Location:
Chromosome 25 (position 5663261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTTGACGGCTGCTTTTTCGTAGACGGAGTCGTCAACTATTTCATGGGT[C/T]GAACGGAGGCTGTGCGGAAGGTCGGATTTGACCCATTCCTCAAAAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link