mylk3

Ensembl ID:
ENSDARG00000076348
ZFIN ID:
ZDB-GENE-030131-3497
Description:
myosin light chain kinase 3 [Source:RefSeq peptide;Acc:NP_001099057]
Human Orthologue:
MYLK3
Human Description:
myosin light chain kinase 3 [Source:HGNC Symbol;Acc:29826]
Mouse Orthologue:
Mylk3
Mouse Description:
myosin light chain kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2443063]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18088 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109918 Essential Splice Site 594 715 11 13
ENSDART00000142981 Essential Splice Site 594 690 11 12
Genomic Location:
Chromosome 7 (position 44555400)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RAGGGTGAACAGATTTAAGTTATTTTYACYCTCTGTGATTTCATTTTTTC[A/T]GTTTGAGTGGCCTTTCTCCATTCMTGGGTGACAACGACGCAGAAACAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/crhav4in