A7MBS5_DANRE

Ensembl ID:
ENSDARG00000076332
Description:
LOC792773 protein [Source:UniProtKB/TrEMBL;Acc:A7MBS5]
Human Orthologue:
IGSF10
Human Description:
immunoglobulin superfamily, member 10 [Source:HGNC Symbol;Acc:26384]
Mouse Orthologue:
Igsf10
Mouse Description:
immunoglobulin superfamily, member 10 Gene [Source:MGI Symbol;Acc:MGI:1923481]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22445 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112149 Nonsense 644 861 5 5
Genomic Location:
Chromosome 14 (position 15445554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTGATAATCAAAACAGTGACACACGAGGATGCTGGAGAGTACAGCTG[T/A]TTAGCAGCTAACCTGTATGGAGCTGATATGTTGTCTCATCTAATTGTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j12p362z