si:dkey-101k6.4

Ensembl ID:
ENSDARG00000076328
ZFIN ID:
ZDB-GENE-081105-135
Description:
Oxysterol-binding protein [Source:UniProtKB/TrEMBL;Acc:B0S5M3]
Human Orthologue:
OSBPL11
Human Description:
oxysterol binding protein-like 11 [Source:HGNC Symbol;Acc:16397]
Mouse Orthologue:
Osbpl11
Mouse Description:
oxysterol binding protein-like 11 Gene [Source:MGI Symbol;Acc:MGI:2146553]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25432 Nonsense Mutation detected in F1 DNA During 2017
sa34711 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110666 Nonsense 423 712 9 14
ENSDART00000131846 Nonsense 423 693 9 13
Genomic Location (Zv9):
Chromosome 9 (position 39596069)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38733965
KASP Assay ID:
554-7770.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACTTCCTTCCATGAAGGTCGCAAAGGTGCCATTGCCAAGAAGCCCTA[C/G]AACCCCATCATCGGAGAGACTTTTCACTGCTCTTGGAATGTGCCCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110666 Essential Splice Site 685 712 12 14
ENSDART00000131846 Essential Splice Site 685 693 12 13
Genomic Location (Zv9):
Chromosome 9 (position 39604506)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38742402
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGCGCTGAGACACAGACACCATGGAGGACCAAATACTTTGAGCGCAAA[G/A]TAAGAGCACTTCTGATTCTTGTATCGGTTTCCGAAATCATTGATAGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link