MAML2

Ensembl ID:
ENSDARG00000076326
Description:
mastermind-like 2 (Drosophila) [Source:HGNC Symbol;Acc:16259]
Human Orthologue:
MAML2
Human Description:
mastermind-like 2 (Drosophila) [Source:HGNC Symbol;Acc:16259]
Mouse Orthologue:
Maml2
Mouse Description:
mastermind like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2389460]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa308 Nonsense F2 line generated During 2014
sa2814 Nonsense F2 line generated During 2014
sa10859 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa308
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108486 Nonsense 345 448 1 2
ENSDART00000108486 Nonsense 345 448 1 2
Genomic Location:
Chromosome 15 (position 3772789)
KASP Assay ID:
554-3156.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAACAGCAGGCACCTTCAGCAGGTCAGGGTAGGCACTTTCARAACTG[C/A]CAGCTGCCCATGCAACCATCTTCATGTCTGCAAACTAAGCCTCCAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2814
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108486 Nonsense 345 448 1 2
ENSDART00000108486 Nonsense 345 448 1 2
Genomic Location:
Chromosome 15 (position 3772789)
KASP Assay ID:
554-3156.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAACAGCAGGCACCTTCAGCAGGTCAGGGTAGGCACTTTCARAACTG[C/A]CAGCTGCCCATGCAACCATCTTCATGTCTGCAAACTAAGCCTCCAAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108486 Essential Splice Site 382 448 1 2
Genomic Location:
Chromosome 15 (position 3772676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATCAACAWGGAGCTGGAATCAGTTTTAAATTGACACARCAGAGACAGG[T/A]AAGTCACTGCATTTAKGGTCTTTTTATTACAGTGCCTACTGTTGCTGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/glcwzksw