LOC564666

Ensembl ID:
ENSDARG00000076324
Human Orthologue:
LMTK2
Human Description:
lemur tyrosine kinase 2 [Source:HGNC Symbol;Acc:17880]
Mouse Orthologue:
Lmtk2
Mouse Description:
lemur tyrosine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:3036247]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40190 Nonsense Mutation detected in F1 DNA During 2016
sa33343 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110030 Nonsense 361 1446 10 14
Genomic Location (Zv9):
Chromosome 3 (position 61885882)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61044407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCCGTATCATCACCTGTCGGACAGAGAAGTGCTCCATCATGTGCTC[A/T]AAGATCAACAAGTCCGACTTCTCAAGCCACAGCTGGACTTGCCATACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110030 Nonsense 546 1446 11 14
Genomic Location (Zv9):
Chromosome 3 (position 61887743)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 61046268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTTTGACGCCCATAAAGCATCCTCTGGAAATGACTACTTTATTAAGT[T/A]GGAGGAACTCGATGAGAGCGAGATTGGGATGGGCGACAGTCAAGGAGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link