LOC564666

Ensembl ID:
ENSDARG00000076324
Human Orthologue:
LMTK2
Human Description:
lemur tyrosine kinase 2 [Source:HGNC Symbol;Acc:17880]
Mouse Orthologue:
Lmtk2
Mouse Description:
lemur tyrosine kinase 2 Gene [Source:MGI Symbol;Acc:MGI:3036247]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40190 Nonsense Mutation detected in F1 DNA During 2016
sa33343 Nonsense Mutation detected in F1 DNA During 2016
sa2136 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110030 Nonsense 361 1446 10 14
Genomic Location:
Chromosome 3 (position 61885882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCCGTATCATCACCTGTCGGACAGAGAAGTGCTCCATCATGTGCTC[A/T]AAGATCAACAAGTCCGACTTCTCAAGCCACAGCTGGACTTGCCATACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110030 Nonsense 546 1446 11 14
Genomic Location:
Chromosome 3 (position 61887743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTTTGACGCCCATAAAGCATCCTCTGGAAATGACTACTTTATTAAGT[T/A]GGAGGAACTCGATGAGAGCGAGATTGGGATGGGCGACAGTCAAGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110030 Nonsense 1089 1446 11 14
Genomic Location:
Chromosome 3 (position 61889372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCTGGACAAGAAAAGCGATGACGTCAGTGGAAACGGCTCTTCAATTT[G/A]GCTTCAGAAYAATCAAGAAACTAATGAAAGTAGGGTAGCTCRCGCTCTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link