MYOT

Ensembl ID:
ENSDARG00000076312
Description:
myotilin [Source:HGNC Symbol;Acc:12399]
Human Orthologue:
MYOT
Human Description:
myotilin [Source:HGNC Symbol;Acc:12399]
Mouse Orthologue:
Myot
Mouse Description:
myotilin Gene [Source:MGI Symbol;Acc:MGI:1889800]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10641 Nonsense Available for shipment Available now
sa8775 Nonsense Mutation detected in F1 DNA During 2016
sa22435 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10641
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115101 Nonsense 116 653 3 11
Genomic Location (Zv9):
Chromosome 14 (position 12509728)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11945501
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCAAAGGGAGTTAAAAACAGTGTTCCACATCCATTCCTTCTCACCAGC[A/T]AGCTGAATAAACAAGTAGAAYCCAAGGGCAGTGCCACGAATGTGGCTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115101 Nonsense 206 653 3 11
Genomic Location (Zv9):
Chromosome 14 (position 12509458)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11945231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGCACCCACTCAGACATTAATGTGTTCCAGCATGACTTTGATTCCT[A/T]AAGCAAGGAGTACTCCAAACAGTGAGAATCTATCACCAGCAGCTTTCCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115101 Nonsense 423 653 7 11
Genomic Location (Zv9):
Chromosome 14 (position 12487618)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11923391
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACAGAAGCCTCTACCATCCAAGAGAAATGTTTTGCTCCTCGTTTTATA[C/T]AAGTGCCTCAAGATGTTACTGTTGAAGAGGGACGATTCTGCAGGATTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link