si:ch211-141h12.1

Ensembl ID:
ENSDARG00000076309
ZFIN ID:
ZDB-GENE-081104-119
Human Orthologue:
MXRA5
Human Description:
matrix-remodelling associated 5 [Source:HGNC Symbol;Acc:7539]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41561 Nonsense Mutation detected in F1 DNA During 2017
sa9164 Nonsense Mutation detected in F1 DNA During 2017
sa1691 Nonsense Available for shipment Available now
sa9588 Nonsense Available for shipment Available now
sa27514 Nonsense Mutation detected in F1 DNA During 2017
sa41562 Nonsense Mutation detected in F1 DNA During 2017
sa21620 Nonsense Available for shipment Available now
sa34797 Nonsense Mutation detected in F1 DNA During 2017
sa31754 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 77 2520 2 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209 Nonsense 68 652 2 4
Genomic Location (Zv9):
Chromosome 9 (position 57757482)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56189025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGATTTAACACCATCAGTCAGATCACAGACGCCTCTTTCAGTGGCCTT[C/T]GAAAGCTGGAGCTGCTGATGATGCACGGGAACAACGTGCAGAAGATACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9164
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 233 2520 3 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209 Nonsense 223 652 3 4
Genomic Location (Zv9):
Chromosome 9 (position 57761618)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56193161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCCWGGAGCTGTGACTGCCGCATGCGCTGGCTGCAGGACTGGAGCGCT[C/T]GACATCCAGGTCAGACATGATCATATTGTAATGGCGATCTWYTTCTTYAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 716 2520 4 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209   None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57763866)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56195409
KASP Assay ID:
554-1637.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACACCGACTCGAAGAAGGCGTCCAAATRCACGTAGGTTTGGGAACATT[C/T]GACATAGACGGCCCTTTAGGAACAGAGCTGGTTTACCAAACCAAAGACCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1006 2520 5 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209   None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57764803)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56196346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CMAAGTGAAGGAAAGTAACTTCCAACAAACTCAGCAAGTGATGCCAAACT[C/A]GAGGYTTCACCCCACAATAKCAACAAATGYATCTGCGGTTTTGAGGTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1141 2520 5 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209   None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57765207)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56196750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAGAGGGTGTTACTTCTACTGAAGAGTCTGTAGTCTCCTCCATACTA[C/T]AATCTCAAACCTATCCTCTTTCAAACCCAAATCAAAGCTTCAAAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41562
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1387 2520 6 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209   None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57765975)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56197518
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAACCAGACTTGGATTCTAAGGTGGGCCAAAGGAACAGATTAATCCCC[G/T]AACTTGAACTTACAACATCAGTTAACACTCCACCTGCAACTACCAGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1470 2520 6 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209   None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57766226)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56197769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGGAACAAACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTA[T/G]CCATACTATCACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1473 2520 6 8
ENSDART00000144757   None 967 None 3
ENSDART00000147209   None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57766235)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56197778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTACATAGGGGGAAGAATTCCTAGTACTAATCATAGGTATCCATACTA[T/G]CACAGTAGAAATATTAAACCCAATATTGACAGAACGCCATCTCTGACCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31754
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110561 Nonsense 1656 2520 7 8
ENSDART00000144757 Nonsense 103 967 2 3
ENSDART00000147209   None 652 None 4
Genomic Location (Zv9):
Chromosome 9 (position 57768591)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56200134
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCACGTTCCCAGGATGACGAGTCCACGCCATCAAGACGTAACGGTGTA[T/A]ATAGGAAACACTGCACTCCTGCAATGCCAAGCACAAGGACTCCCAATCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link